CHEM132 Winter 2020 Proteins and Nucleic Acids Assignment - 4 Instructions: 1. This assignment must be completed independently. · There is little/no reason for your answers to be the same as anyone...

You don't have to reference or cite anything. It just has to be different than the answers on Chegg.


CHEM132 Winter 2020 Proteins and Nucleic Acids Assignment - 4 Instructions: 1. This assignment must be completed independently. · There is little/no reason for your answers to be the same as anyone else in the class. Academic Dishonesty will result in a grade of zero. 2. Read all of the questions carefully. They are not meant to be “trick” questions, but they are very specific in what they are ask. 3. This assignment will focus on proteins and nucleic acids. 4. You have one week to complete and submit your assignment: Due by Friday May 1st (11:59pm) 5. Assignments need to be converted into a pdf and submitted though the “Turn In:” link located on the course website. (same steps you used for the previous submissions) If you have questions let me know Dr. Root CHEM132 Winter 2020 Proteins and Nucleic Acids Assignment - 4 Name (first, last) ________________________________________________________________ Question 1 Show the equation (using structural formula) for an acid/base reaction between the amino acid threonine and sodium hydroxide. Question 2 Show the equation (using structural formula) for an oxidation reaction using two cysteine amino acids. Question 3 Briefly explain why all amino acids are soluble in water at physiological pH (pH=7.35) Question 4 Draw the structure of the tripeptide asp-lys-pro at pH=3 and calculate its net charge. Name (first, last) ________________________________________________________________ Question 5 Calculate the isoelectric point of the dipeptide CY. Show your work. Question 6 Briefly describe the four levels of protein structure. Name (first, last) ________________________________________________________________ Question 7 Show the product(s) from the base catalyzed hydrolysis of the tripeptide in Question 4 Question 8 Show the structure of the nucleoside that forms involving cytosine. Question 9 Show the hydrogen bonding that occurs between adenine and uracil. Question 10 Briefly describe the process of transcription. Name (first, last) ________________________________________________________________ Question 11 Briefly describe the process of translation. Question 12 Describe the process of information transfer for an organism with discontinuous genes. Question 13 Identify the amino acids that are coded for by the following prokaryotic mRNA sequence. 3’- AGAAUCGCAAAUGACCUCGCAGGGUAGC -5’