There are 7 questions in total.
Module 2 Assignment – Polymerase Chain Reaction, Electrophoresis, and Standard Curves Students must submit their completed work in Crowdmark. If this is not done by the deadline, your work will be marked as late. You must submit your work typewritten in either doc or pdf format, and submission of non-standard file formats or submissions of photos will receive a zero. Please ensure you give yourself enough time for proper submission and ensure that your answers are uploaded in the correct location, otherwise your work may not be graded. Answers that are ambiguous, unclear, or do not follow instructions will be penalized or receive no credit. Students are expected to work independently, and any work submitted must be your own. Students who post assignment content on group chats and third-party websites will be in violation of both the Senate Policy on Academic Honesty and/or the Canadian Copyright Act. You have started as a new undergraduate research associate in Dr. Nik Kovinich’s research lab. Recall that you were responsible for reading the abstract for a scientific journal article from his research group. One of the most common tasks that an undergraduate volunteer may be asked to do in a research lab is to amplify a gene by PCR for further study. Such a task forms the first step of a basic undergraduate cloning project. The first step in the project you are given by Dr. Kovinich is to successfully amplify the DNA that codes for the GmMYB103 gene, which is one of the candidate transcription factors that his group has identified from the genetic screen described in the Module 1 reading assignment. Core Questions 1. (2 points) Find the CDS of the GmMYB103 gene in Glycine max using any genomic reference database. The unique Phytozome identifier for this gene is Glyma.07G054000. Provide the sequence of the last 25 nucleotides in the protein-coding region. 2. (4 points) Dr. Kovinich asks you to generate a pair of DNA primers that can be used to amplify the protein coding region of this gene in a PCR reaction, using an appropriate DNA template that he will provide. Provide the sequence of these two primers in the 5’ to 3’ orientation. For the sake of simplicity, the primer sequences should be 20 nucleotides each. 3. (6 points) You assemble the PCR reaction according to the following protocol, which you obtained from the dusty old lab notebook of a previous graduate student in Nik’s lab. The volume of stock solutions and expected final concentrations are indicated for a 25 µl reaction. However, the reaction fails. Stock Component Theoretical Expected Final Concentration/Amount Volume of stock Added to Assemble 25 µl Reaction 10X Reaction Buffer 1X 2.5 µL 10 mM dNTPs 200 µM 0.5 µL 5 µM Forward Primer 0.2 µM 5 µL 5 µM Reverse Primer 0.2 µM 5 µL 0.5 µg/µL Template DNA 250 ng 0.5 µL 10 unit/µL Taq DNA Polymerase 0.05 units/ µL 1 µL Water N/A 11.75 µL Dr. Kovinich asks you to explain your failed result in a weekly lab meeting, and why you think this PCR reaction failed. Explain what is wrong with this PCR reaction, and the specific correction(s) you would make to fix this problem, if any. Also be sure to explain what effect the errors may have on the reaction results 4. (3 points) Dr. Kovinich asks you to develop a control sample to run in parallel with your PCR that provides some form of evidence that the reverse primer is complementary and specific for the GmMYB103 gene. Construct and describe such a control experiment in two grammatically correct sentences, at most. You may assume that your PCR will work as expected. Continued below 5. To check whether your revised PCR was successful, you load and run an agarose gel with molecular weight standards (lane MW) and your PCR reaction. Two other summer students in the lab ask if they can run samples from their experiments on your gel, and you allow them to do so. However, in your haste, you failed to record who was loaded in which lane. The distance of migration for all bands are indicated. a. (4 points) Construct a standard curve in Excel that relates the distance of migration in centimeters to the log of DNA fragment length in basepairs (bp). Note that the log of fragment length is linearly related to the distance migrated. Please treat the distance migrated as the independent variable, do not round any values, and do not exclude pertinent data in the construction of your standard curve. Only provide the equation of the linear regression line for grading, in the standard form y=mx+b. Submissions will be penalized for extraneous information. b. (3 points) Given this standard curve, what are the sizes (in bp) of the DNA fragments in each of the three lanes? Round to the nearest whole number if necessary. Submissions will be penalized for extraneous information. c. (3 point) Out of these three predicted DNA fragment sizes, are there any values you are not confident about? If so, why? Answer in a couple of grammatically correct sentences. d. (2 points) Which lane do you think contains your PCR reaction? Why? Answer in two grammatically correct sentences at most. Size (bp) Lane Distance Migrated (cm) 10000 MW 1.1 8000 MW 1.2 6000 MW 1.6 5000 MW 1.7 4000 MW 2.2 3000 MW 2.6 2000 MW 3.6 1500 MW 4.5 1000 MW 5.9 500 MW 9.0 Unknown 1 7.9 Unknown 2 9.2 Unknown 3 6.6 6. PCR Analysis: You have isolated E. coli genomic DNA from 2 different cultures and used tested primers (so they should work) to attempt to amplify the MetB gene (encodes Cystathionine gamma- synthase) by PCR. The resulting PCR products were run on an agarose gel. The PCR conditions were the same the same for both samples except Sample A was performed at a lower annealing temperature. You can find the size of the expected PCR product assuming that the primers were made to anneal at the beginning and end of the MetB gene. Are the resulting PCR products the expected size? Do you have any concerns about the size determination? What is the band labelled “X”? Is X an expected or unexpected result? Explain. Analyze the results and explain if you were successful or not in isolating the Met B gene fragment from both cultures. If there is something wrong with the result explain what it is and how it could have occurred. What would you do to ensure that the failed result will have a better chance at success next time? Use one page to clearly analyze your results as though you were explaining this to a boss or client. Figure 1: PCR results separated on an agarose gel Lane 1 = DNA ladder: Diamond 100bp ladder from Rockland (see below) Lane 2 = PCR Sample A Lane 3 = Negative control. No taq Lane 4 = PCR Sample B DNA Ladder: Optional Extension Questions 7. (3 bonus points) Frontotemporal dementia (FTD) is a neurodegenerative disease “look-alike” that is clinically indistinguishable from Huntington’s disease, and often causes diagnostic confusion. Thus, identifying FTD correctly is of major medical interest. FTD is thought to be caused by the expansion (i.e. a greater number) of GGGGCC hexanucleotide repeats in the C9ORF72 gene. Normal individuals appear to have less than 30 of these repeats in both of their copies of the C9ORF72 gene, whereas affected individuals have greater than 100 of these repeats in at least one copy of the C9ORF72 gene. A portion of the human genomic sequence for the C9ORF72 gene where these repeats are found is shown below. The location of the repeats is indicated by (GGGGCC)N, where N is the number of repeats. GGTGAACAAGAAAAGACCTGATAAAGATTAACCAGAAGAAAACAAGGAGGGAAACAACCGCAGCCTGTAG CAAGCTCTGGAACTCAGGAGTCGCGCGCTA-(GGGGCC)N-GCTGCGGTTGCGGTGCCTGCGCCCGCGGC GGCGGAGGCGCAGGCGGTGGCGAGTGGGTGAGTGAGGAGGCGGCATCCTGGCGGGTGGCTGTTTGGGGTT You are asked to conduct a PCR reaction using genomic DNA from three different individuals to confirm a clinical diagnosis of FTD. The 20 nucleotide primers used are known to amplify the hexanucleotide repeat region. The primer sequences used in the PCR are as follows: Forward Primer: AACTCAGGAGTCGCGCGCTA Reverse Primer: GCAGGCACCGCAACCGCAGC The physician provides the following information about the patients: • Individual A is symptomatic for FTD and is a heterozygote: they have 75 hexanucleotide repeats on one copy of their C9ORF72 gene, and 20 repeats on the other copy of their C9ORF72 gene. • Individual B is asymptomatic for FTD and is a homozygote: they have 20 repeats in both of their copies of the C9ORF72 gene • Individual C is symptomatic for FTD and is a homozygote: they have 130 repeats in both of their copies of the C9ORF72 gene You run these PCR products on a gel. Indicate what you expect to see for these three individuals on the gel template below and indicate the exact theoretical size (in bp) of the amplified DNA fragments in all three lanes. Lane 1: 2 bands – 490, 160 Lane 2: 1 band – 160bp Lane 3: 1 band – 820bp