Select one of the following labs, and write a Lab Report of 1 page that you will submit to "Submitted Assignments." Options 1: Crime Scene Forensics In recent years, law enforcement has been...

Select one of the following labs, and write a Lab Report of 1 page that you will submit to "Submitted Assignments."

Options 1: Crime Scene Forensics

In recent years, law enforcement has been revolutionized by molecular biology. When human tissues are left behind at crime scenes, these tissues can be collected and processed to yield samples of DNA, which can then be treated to isolate specific DNA fragments that are highly variable in the human population.
Statistically, any 2 people are very unlikely to have a matching set of these DNA fragments. Thus, if a DNA profile obtained from a suspect matches the DNA profile produced from the crime-scene evidence, authorities can be very sure that the suspect was at the crime scene.
In this lab activity, you will prepare DNA samples from 4 suspects, produce DNA profiles for each, and compare those profiles to a sample that was produced from DNA collected at a crime scene.

Option 2: Is An Endangered Species Being Traded Illegally?

Molecular biology techniques such as DNA sequencing are important tools for enforcing laws that protect threatened or endangered species. Just as human tissue collected at a crime scene can yield DNA that can be used to identify victims and suspects, unidentifiable animal tissues (e.g., dried shark fins, powdered mammal bone and teeth, and dried internal organs) can be analyzed to determine if it was taken from a protected species.
You are to write a 1-page Lab Report using the Scientific Method sections below. Your Pearson report is your data to support your report. Attach the Pearson report as part of your lab report results. The Pearson questions are to help you understand the topic and may be used in your report to support your findings.

Complete the steps of the scientific method for your lab option choice. Use these headings in your paper, please.



Purpose:

State the purpose of the lab.

Introduction:

This is an investigation of what is currently known about the question being asked. Use background information from credible references to write a short summary about concepts in the lab. List and cite references in APA style.

Hypothesis / Predicted Outcome:

An hypothesis is an “educated guess.” Based on what you have learned and written about in the Introduction, state what you expect to be the results of the lab procedures.

Methods:

Summarize the procedures that you used in the lab.
The Methods section should also state clearly how data (numbers) were collected during the lab; these will be reported in the Results/ Outcome section.

Results/Outcome:

Provide here any results / data that were generated doing the lab procedure.

Discussion/Analysis:

In this section, state clearly whether you obtained the expected results, and the outcome was as expected. Note: You can use answers to any multiple choice or essay questions you filled out in the lab to help you discuss the results and what you learned.
Provide references in APA format. This includes a reference list and in-text citations for references used in the Introduction section.
Give your paper a title and number and identify each section as specified above. Although the hypothesis will be a one sentence answer, the other sections will need to be paragraphs to adequately explain your experiment.
Virtual Molecular Lab: Crime Scene Forensics

Learning Goal:To gather forensic evidence from a crime scene and match it to likely suspects.

Prerequisite Knowledge:Before beginning this lab, you should be familiar with these concepts:

• howforensic scientiststake advantage of genomic variations in noncoding regions of DNA


• the techniques of polymerase chain reaction (PCR) and gel electrophoresis

Introduction:In recent years, law enforcement has been revolutionized by molecular biology. When human tissues are left behind at crime scenes, these tissues can be collected and processed to yield samples of DNA, which can then be treated to isolate specific DNA fragments that are highly variable in the human population.
Statistically, any two people are very unlikely to have a matching set of these DNA fragments. Thus, if a DNA profile obtained from a suspect matches the DNA profile produced from crime-scene evidence, authorities can be very sure that the suspect was at the crime scene.
In this lab activity, you will prepare DNA samples from four suspects, produce DNA profiles for each, and compare those profiles to one produced from DNA collected at a crime scene.

Part A

Investigators have recovered a strand ofhuman hairfrom the ledge of a window where a burglar broke into a home. DNA has been extracted from the hair. Meanwhile, four suspects, all of whom have similar types of hair, have been apprehended and DNA samples have been taken from each of them.
To produce DNA profiles for each suspect and for the hair sample, you will first need to amplify specific regions of the genomes where noncoding regions of DNA tend to be duplicated, or repeated. The specific number of repeats at such a region is likely to differ from one genome to the next. If you can isolate these DNA segments, amplify them, and perform gel electrophoresis, you will be able to compare the DNA profiles of the suspects with that of the DNA extracted from the crime-scene evidence.
Enter the Molecular Lab Room by clicking the button. Then, follow the Lab Procedure.

IMPORTANT:Before exiting the lab room, be sure to select the "Save File" option in the

Lab Book

so that your data will be stored for later reference.

Lab Procedure Begin your analysis by gathering the samples. Roll over the five labeled microcentrifuge tubes in the tube rack to see which DNA samples they contain. Alab assistanthas already added theTaqpolymerase along with the raw nucleotide building blocks (dNTPs tag) that will be used to amplify the targeted fragments during polymerase chain reaction (PCR). Add Primers Before putting the tubes into the PCR machine, you need to add primers that will snip out the targeted regions of each genome. To do this, click on the primer control projector, which is located right behind the test tube rack. The primers you need for this process are not in the standard menu, so you need to copy/paste them into the blank field at the bottom of the primer selector. Here are the two primers to add: Left primer gaaactggcctccaaacactgcccgccg Right primer gcaaggggcacgtgcatctccaacaaga Copy/paste one primer into the blank field, and then clickAdd.It will appear at the top of the primer menu with an asterisk (*) to mark it. Clear the field at the bottom of the primer selector, and then copy/paste in the next primer and clickAdd.It will also appear at the top of the menu with an asterisk (*). Once these two custom primers are in the menu, select one of them from the menu and use the pipette icon to generate a pipette loaded with that primer. (The Primers door will open and close to indicate that the primer has been loaded, and the pipette will lean to the left.) Move the pipette over the first tube until it straightens up. Then, click on the pipette and it will lean to the right, indicating that the primer has been inserted into the tube. This image shows the three positions of the pipette and what they indicate. Reload the active pipette by clicking its tip on the pipette icon at the bottom of the primer window. Add the primer to the next tube. Continue this process of inserting and reloading until all five tubes have received the first primer. Select the other custom primer from the list, and add it to each tube following steps 5-7. Remember: If you fail to add both the left and right primer to each DNA sample you will not amplify a particular segment and your analysis will be inaccurate. Run PCR Your primed DNA samples are now ready for the PCR machine. (To review how to run the PCR,watch this video.) Open the PCR machine lid, and drag all of the tubes to the empty slots in the machine. Close the lid, and click the green arrow to start the PCR, which will amplify the targeted segment in each sample. Because PCR takes over 3 hours, use the arrows on the main clock to advance time by just over 3 hours, until the machine’s display readscomplete. Open the PCR machine lid, and drag each tube back to the main tube rack. Maintain the original order of the tubes. Run Gel Electrophoresis Now that you have amplified the fragments, the next step is to load the samples into the gel and run gel electrophoresis. (To review how to run the gel,watch this video.) Click on the pipette on the lab bench, and hover over the tube labeledDNA from crime scene.The pipette will straighten up when it is in position to take up some of the DNA from the tube. Click, and the pipette will tilt to the left, indicating that it is loaded with that sample. Move the pipette over to the gel, which is near the front of the lab bench to the right of the PCR machine. Slowly move the pipette tip over the back edge of the gel until you see the wordsWell #2appear in yellow. Click, and Well #2 will receive theDNA from crime scenefragments. As usual, the right-leaning pipette indicates that the pipette has been emptied. Repeat steps 12 and 13 for the other four samples. Be careful to not load more than one sample into any of the wells. Use the information below to coordinate the transfer of samples to wells. Sample Load into… Wells 1 and 10 are left alone because standard DNA ladders--nucleotide sequences that provide scale for the other samples--are already in those wells. DNA from crime scene Well 2 Suspect 1 Well 3 Suspect 2 Well 4 Suspect 3 Well 5 Suspect 4 Well 6 Now that the wells are loaded, you need to hook up the electrodes and turn on the gel. Grab the red (positive) electrode, and drag it to the terminal on the front left corner of the gel. Drag the black (negative) electrode to the other terminal, not far behind the positive one. Click on the main power button of the gel’s power supply, beneath the bench. A light above the button will glow red to indicate that the main power supply is on. To send the current through the gel and begin electrophoresis, click on the gray button that readsoff.It will then readon,the light will turn green, and the gel will project into view overhead. As with other molecular biology processes, the gel takes some time to run its course. To speed the process, click on the arrows of the main clock to advance time by 10 minutes. As you click, the DNA fragments in the gel will move from the wells toward the positive end. To see how far the fragments traveled (which is an indication of how large they are), click on theUVbutton at the top of the gel viewer window. Analyze the gel by comparing the pattern of bands in the lanes. Pay special attention to the brightest band in each lane, where the amplified fragments of the targeted gene have accumulated in the gel. (Remember that Wells 1 and 10 were preloaded with standard DNA ladders that serve as scales for the fragments in the other wells. Lanes 2 through 6 show the targeted fragments from the crime-scene DNA and the four suspects.) Click theSavebutton in the gel viewer to save a black-and-white copy of the gel to your Lab Book. The gel image will remain in the Lab Book until you exit the Lab Room or close your browser window.

Which band pattern among Lanes 3 to 6 seems to be the closest match to the band pattern in Lane 2, where the crime-scene DNA fragment was loaded? Which suspect appears to be the culprit?

ANSWER:
Which band pattern among Lanes 3 to 6 seems to be the closest match to the band pattern in Lane 2, where the crime-scene DNA fragment was loaded? Which suspect appears to be the culprit?

Lane 3 (Suspect 1)

Lane 4 (Suspect 2)

Lane 5 (Suspect 3)

Lane 6 (Suspect 4)

Part B

Use the horizontal tool (the circular icon in upper right of gel viewer) to measure the molecular weight, in base pairs, of the brightest band in each lane. Be sure to aim the horizontal tool’s line at the middle of a given fragment to measure its approximate size.

What is the molecular weight (in base pairs) of the fragment in Lane 2 (DNA from the crime scene), Lane 3 (Suspect 1), Lane 4 (Suspect 2), Lane 5 (Suspect 3), and Lane 6 (Suspect 4)?

ANSWER:

Essay answers are limited to about 500 words (3800 characters maximum, including spaces).

3785Character(s) remaining

Part C


How does analyzing DNA profiles using the gel electrophoresis tool allow you to draw both qualitative and quantitative conclusions about the likely identity of the suspect in this case?

ANSWER:

Essay answers are limited to about 500 words (3800 characters maximum, including spaces).

3785Character(s) remaining

Part D

Suppose the nucleotide sequence targeted by the primers in this activity is composed of a number of repeats of a single 16-base-pair sequence. In other words, every repeat within the targeted sequence means another 16 base pairs in the genome.

Judging by the sizes of the fragments you measured in Part C, about how many repeats of the 16-base-pair sequence would you expect to find in each of the suspect’s genomes?

ANSWER:

Essay answers are limited to about 500 words (3800 characters maximum, including spaces).

3785Character(s) remaining

Part E -Think It Over
In this lab activity, you targeted just one fragment of DNA to build the DNA profile of each suspect and the crime-scene sample. Real-world DNA profiles target multiple fragments.

What is the advantage of targeting more than one fragment and having each DNA profile feature multiple bands?

ANSWER:

Essay answers are limited to about 500 words (3800 characters maximum, including spaces).

3785Character(s) remaining
Score Summary:
Your score on this assignment is 0.0%.
You received 0 out of a possible total of 1 points.

This what happen when I did the lab

Virtual Molecular Lab: Is an Endangered Species Being Traded Illegally? - Copy

Learning Goal:To use modern molecular biology lab techniques to determine if parts of a critically endangered species are being traded illegally.

Prerequisite Knowledge:Before beginning this lab, you should be familiar with these concepts:

• how gene sequences can be used to identify the origin of unknown DNA samples


• the techniques of polymerase chain reaction (PCR) and DNA sequencing

Introduction:Molecular biology techniques such as DNA sequencing are important tools for enforcing laws that protect threatened or endangered species. Just as human tissue collected at acrimescene can yield DNA “fingerprints” that can be used to identify victims and suspects, unidentifiable animal tissues such as dried shark fins, powdered mammal bone and teeth, and dried internal organs can be analyzed to determine if they were taken from protected species.
In this lab activity, you will act as a wildlifeforensicspecialist. You will use DNA sequencing to determine if parts of tigers -- carnivores protected by laws in some countries -- are being illegally traded.

Part A -Amplifying samples of DNA
The tiger is a large and critically endangered predatory cat. It is endangered due to habitat loss and also because there is high demand for its bones, teeth, organs, and skin for use in traditional medicines in parts of Asia. Governments have restricted and, in many cases, outlawed this trade, but the black market for tiger parts remains strong.
Your wildlife forensics lab has received unidentified samples of powdered mammalian teeth and bone that were confiscated from luggage at international airports in and around Southeast Asia. Your task is to compare DNA sequences extracted from the physical evidence with DNA that you know was sampled from a tiger. If there are any matches, you will know that tiger tissues are being traded.
Enter the Molecular Lab Room by clicking the button. Then follow the Lab Procedure.

IMPORTANT:Before exiting the lab room, be sure to select the "Save File" option in theLab Bookso that your data will be stored for later reference.

Lab Procedure First, you will prepare a sample of known tiger DNA that you will compare your unknown samples to. (Notice that your unknown samples are contained in fourmicrocentrifugetubes in the tube rack. Roll over the tubes to see which DNA samples they contain.) Drag an empty microcentrifuge tube from theEmpty Tubesjar to the tube rack. Hover over the tube, and then click in the blank gray box on the face of the tube rack so you can label the tube. Use “Tiger DNA” or something similar as your label. In theSpecies Selector, the tiger will already be selected for you. Click on thepipette iconbelow the species list. You now have a pipette loaded with tiger DNA. Hover over your newly labeled Tiger DNA tube until the pipette straightens up. Click to put the DNA into the tube. Once the pipette is leaning to the right, you’ll know that the DNA is in the tube. (For help using the pipette,watch this video.) Now you will add PCR reagents to your Tiger DNA tube. Do this by clicking on theTaqjar, which will give you a loaded pipette. Then hover over the tube and click (as you did with the DNA pipette) to insert the reagent into the tube. Do the same withdNTPs tag. (Make sure you do not add “dNTPs.”)Note:These PCR reagents have already been added to the other four tubes containing your unknowns. You will now add primers to each of your samples that are specific to the ATP6 gene, which will serve as the point of comparison between your tiger DNA sample and the DNA extracted from the unidentified samples. Click on the small projector behind the tube rack to open thePrimer Controls. For each of the primers shown below, copy and paste them one at a time into the blank field at the bottom of the primer selector. ClickAddfor each one. Now they will appear at the top of the primer menu with asterisks (*). Left primer atgaacgaaaatctattcacc Right primer ttaagtattatcatgtaa Select one of the primers you just added to the list, click thepipette iconbeneath the list, and use the loaded pipette to add that primer to the first tube in the rack. Then reload the primer pipette and add it to the next tube. (To reload, simply click the pipette’s tip on the pipette icon below the list of primers.) Repeat until you have added the first primer to all of the tubes. Repeat with the second primer.Be sure to add both primers to all of the tubes. Finally, use PCR to amplify the ATP6 gene from each DNA sample. Drag each tube into thePCR machine. Close the lid and click the green arrow to start the machine. This process, called polymerase chain reaction (PCR), makes multiple copies of the particular gene you are targeting—in this case, ATP6. (For help running the PCR,watch this video.) PCR takes a while, so click on the arrows on the main lab clock to advance time by a little more than 3 hours. You will now see that the PCR reads “complete,” and that 35 cycles have been performed. Drag the tubes back to the tube rack.

Describe what is contained in each of your sample tubes at this point.

ANSWER:

Essay answers are limited to about 500 words (3800 characters maximum, including spaces).

3785Character(s) remaining

Part B

This question will be shown after you complete previous question(s).

Part C

This question will be shown after you complete previous question(s).

Part D

This question will be shown after you complete previous question(s).
Score Summary:
Your score on this assignment is 0.0%.
You received 0 out of a possible total of 1 points.
Virtual Molecular Lab: Is an Endangered Species Being Traded Illegally? - Copy

Learning Goal:To use modern molecular biology lab techniques to determine if parts of a critically endangered species are being traded illegally.

Prerequisite Knowledge:Before beginning this lab, you should be familiar with these concepts:

• how gene sequences can be used to identify the origin of unknown DNA samples


• the techniques of polymerase chain reaction (PCR) and DNA sequencing

Introduction:Molecular biology techniques such as DNA sequencing are important tools for enforcing laws that protect threatened or endangered species. Just as human tissue collected at acrimescene can yield DNA “fingerprints” that can be used to identify victims and suspects, unidentifiable animal tissues such as dried shark fins, powdered mammal bone and teeth, and dried internal organs can be analyzed to determine if they were taken from protected species.
In this lab activity, you will act as a wildlifeforensicspecialist. You will use DNA sequencing to determine if parts of tigers -- carnivores protected by laws in some countries -- are being illegally traded.

Part A -Amplifying samples of DNA
The tiger is a large and critically endangered predatory cat. It is endangered due to habitat loss and also because there is high demand for its bones, teeth, organs, and skin for use in traditional medicines in parts of Asia. Governments have restricted and, in many cases, outlawed this trade, but the black market for tiger parts remains strong.
Your wildlife forensics lab has received unidentified samples of powdered mammalian teeth and bone that were confiscated from luggage at international airports in and around Southeast Asia. Your task is to compare DNA sequences extracted from the physical evidence with DNA that you know was sampled from a tiger. If there are any matches, you will know that tiger tissues are being traded.
Copy of what I got from Lab