Rana frogs were morphologically similar, but based on their mitochondrial DNA sequences below, they are not the same. Rana palustris Rana pipiens TTTCAAGTAGA AGTGAA A AGCC T CCGAGCTTA TTTTCA...

15

Extracted text: Rana frogs were morphologically similar, but based on their mitochondrial DNA sequences below, they are not the same. Rana palustris Rana pipiens TTTCAAGTAGA AGTGAA A AGCC T CCGAGCTTA TTTTCA AGTAGAAGTGA A A AGCCT СCGAG СТТА Rana clamitans TCTTAAGTAGAGGTGATAAGCCT CC ААСТТА Rana catesbiana TTCTTAAGTAGAGGTGATAAG CCT СCGAA СТТА Rana sylvatica TTTTTA AGTAGAGGTGATAAGCC CGAACTTA Which of the following statements best supports the relationship and relatedness among Rana frog species? O By analyzing the fossil record alone, you could be able to devise a phylogeny about Rana frogs and other related common ancestors. Estimate the relatedness among organisms primarily by counting the number of differences in DNA sequences and the anatomy of their fossil ancestors. O Count the number of nucleotide sequences if a mutation occurred. O Rana frogs are unique to each other and there is no absolute significant relationship among this group of organisms.