the exam is in the files
MIC 102 Introductory Microbiology | MIDTERM 2 Page 1 of 8 Spring 2020 NAME (all caps) ______________________________ STUDENT ID ______________ INSTRUCTIONS: Read the detailed exam instructions, which are posted on Canvas > Assignment > Midterm 2, before starting this exam. Follow them carefully. • Write in your name and Student ID (above). • Read and sign the Academic Integrity Affirmation (below). • Write your responses by hand, in easy-to-read, high-contrast ink or pencil, and in reasonably-large font size. • Upload a high-quality scan of your answer form to Canvas > Gradescope > Midterm 2 before 10:30 AM on Wednesday, May 20. ACADEMIC INTEGRITY AFFIRMATION: As a student at UC Davis, I hold myself to a high standard of integrity. By signing and accepting the statement below, I reaffirm my pledge to act ethically and honor the UC Davis Code of Academic Conduct. I hereby verify that the work I submit is the result of my individual effort. I did not consult with or receive help from any person other than the instructor, nor did I help others. I also understand that disciplinary sanctions will be imposed if misconduct is determined to have taken place (up to an F in the course, up to dismissal from the University). FULL NAME (SIGNATURE) _________________________________________ https://ossja.ucdavis.edu/code-academic-conduct https://ossja.ucdavis.edu/code-academic-conduct MIC 102 Introductory Microbiology | MIDTERM 2 Page 2 of 8 Spring 2020 FACTORS INVOLVED IN DNA REPLICATION AND CELL DIVISION. 1. (4 pts) List four ways in which in vivo lagging-strand DNA replication is different from in vitro DNA replication (PCR): 2. (3 pts) The minCDE operon is shown above (link to EcoCyc genome view). How would the expression and localization of minC, minD, and minE be impacted if a 2000 bp (kbp) transposon inserted itself into minD? 3. (3 pts) Where is cell division most likely to occur in this transposon mutant (above): at the midpoint, near the ends of the cell, at multiple sites along the length of the cell, or nowhere (if cell division cannot occur in this mutant)? Explain your reasoning, including discussion of other factors that influence the site of cell division. https://ecocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&object=EG10597&chromosome=COLI-K12 MIC 102 Introductory Microbiology | MIDTERM 2 Page 3 of 8 Spring 2020 NECESSITY OF HELICASE ACTIVITY. 4. (1 pt) A researcher discovered a new antibacterial drug, ZipX, that inhibits all DNA and RNA helicase-type activity in bacterial cells. Describe the general function (catalytic activity) of a helicase. 5. (3 pts) For each cell process listed below, indicate whether or not that process would be directly impacted by ZipX in bacterial cells, and explain your reasoning. DNA repair Transcription Translation 6. (2 pts) Based solely on its mechanism of action and cellular target(s), predict whether the therapeutic index of ZipX would be high or low. Explain your answer. MIC 102 Introductory Microbiology | MIDTERM 2 Page 4 of 8 Spring 2020 THE IMPORTANCE OF BEING METHYLATED. 7. (1 pts) Describe the catalytic activities of a methylase (how it performs its function): 8. (4 pts) Predict the direct impact of a loss-of-function mutation in the methylase involved in each of the following processes. Your answer should discuss its impact on both the specific process and phenotype of the cell (e.g. growth, survival). A. DNA replication: B. Restriction-modification system: 9. (2 pt) Your father is a history teacher at a local elementary school, and is extremely vocal about how he hates “germs”. He tells you that, when the school opens again, he will stock his classroom with lots of antibacterial hand sanitizer, containing antibiotic-like chemicals, to “keep everyone healthy”. Briefly explain why this is not a good idea, using non-scientific terms such that a non-scientist could understand and explain it to others. [Based on a student-submitted question] MIC 102 Introductory Microbiology | MIDTERM 2 Page 5 of 8 Spring 2020 REGULATION OF THE LAC OPERON. 10. (3 pts) Sketch the lac operon, including only the listed elements (below) and labeling each. You may draw multiple copies of an individual element if appropriate. CRP-cAMP (bound to binding site), LacI (bound to binding site), lacY gene, lacZ gene, Shine-Dalgarno sequence, promoter, and transcriptional terminator. 11. (3 pts) Assume your drawing (above) represents the status of the operon in a live bacterial cell growing in culture. Based on the regulatory factors (above), indicate whether glucose and/or lactose are present in the media. Explain your answer. Setup: Use a codon chart to translate the following partial nucleotide sequence of the 5’ end of the lacI gene. Write the single letter amino acid code below the encoding nucleotides. (Codon chart posted on the Midterm 2 Canvas Assignment.) ATGACTTCTGTAACTCTTGCTCAG… 12. (1 pt) Translate the entire nucleotide sequence again, writing only the single letter amino acid codes, with the indicated replication error (emphasized in bold below). ATGACTTCTGTAAACTCTTGCTCAG… MIC 102 Introductory Microbiology | MIDTERM 2 Page 6 of 8 Spring 2020 13. (2 pt) Predict how this mutation will impact the structure and function of LacI. 14. (4 pt) Predict how this mutation will impact the cell with regard to its ability to catabolize lactose and relative growth rate. Explain your answer. A “WHO DUNNIT?” OF DNA TRANSFER. 15. (3 pt) A multi-stage experiment was conducted with two different species: a non- pathogenic strain of Buttiauxella agrestis (Ba) and a strain of Haemophilus influenzae (Hi) carrying a plasmid with a virulence gene (Hi/pVir). The cultures were treated as described for each stage (1-5, below), then inoculated into healthy mice. The mice were observed 24 hours later. 1. When Ba was inoculated → the mice lived 2. When Hi/pVir was inoculated → the mice died 3. When heat-killed Hi/pVir was inoculated → the mice lived 4. When Hi/pVir was mixed with Ba, the mixed cells were incubated for an hour, and then only the Ba cells were inoculated → the mice died 5. When Hi/pVir was first heat-killed before being mixed with live Ba, the mixed cells were incubated for an hour, and then only the Ba cells were inoculated → the mice lived Which was the method of DNA transfer: transformation, transduction, or conjugation? Explain your answer, including discussion of which species was the recipient and donor. MIC 102 Introductory Microbiology | MIDTERM 2 Page 7 of 8 Spring 2020 CONSIDER THE FOLLOWING BIOSYNTHETIC REACTION. (Link to MetaCyc Reaction, provided in case you wish to view a larger version of the image.) 16. (3 pt) Identify the precursor metabolite that became the ribose in the ATP and UTP during biosynthesis, and list the feature(s) of this precursor that make(s) it an appropriate starting molecule. NITROGEN FIXATION AND CYCLIC PHOTOSYNTHESIS. 17. (2 pt) Given that nitrogenase is inactivated by O2, would you expect expression of this enzyme to be induced or repressed by the presence of O2? Briefly explain your rationale. https://biocyc.org/META/NEW-IMAGE?type=REACTION&object=CTPSYN-RXN MIC 102 Introductory Microbiology | MIDTERM 2 Page 8 of 8 Spring 2020 18. Killem X is a chemical used to kill off photosynthetic organisms that perform cyclic photophosphorylation. Its mechanism of action is to oxidize the first complex in the cyclic photophosphorylation electron transport chain. A. (4 pt) How would oxidation of an electron transport chain component by Killem X lead to the death of an organism performing cyclic photosynthesis? B. (2 pt) Killem X is also a potent inhibitor of nitrogen-fixation by cyanobacteria. Explain why an inhibitor of cyclic photophosphorylation would also inhibit nitrogen fixation in these bacteria. [Based on a student-submitted question]