I need help with a simulation exercises and question on evolution. In the dog domestication...

Question

I need help with a simulation exercises and question on evolution. In the dog domestication exercises, you will compare DNA sequences of wolves and construct phylogenetic trees. Then you will simulate events that led to the domestication of dogs.

Exercise 3: Dog Domestication In the dog domestication exercises, you will compare DNA sequences of wolves and construct phylogenetic trees. Then you will simulate events that led to the domestication of dogs. By doing so, you will gain a thorough understanding of evolution, population genetics, and domestication. To complete these exercises, you will use SimBio simulation software and an accompanying workbook, which you will access online. The workbook that comes with the software provides the theoretical background for the activities and the questions that you will complete and submit to your professor for grading. Time requirement: This simulation exercise takes about three or four hours. The activities are broken down into six exercises, each of which can be done independently. It is important, however, to follow the sequence provided. If possible, try to find a partner for Exercise 5. If you don’t have a partner, take notes about the time of your dog domestication activities and about where the wolves came from while you run the simulation in Exercise 5. These notes will be helpful for your subsequent interpretation. Exercise 6: You are not required to answer question 1.1. Instead, answer the following question: Based on the data in the cladogram provided in Exercise 6, do you think all domesticated dogs came from the same lineage of wolves? Or, in other words, was the domestication of dogs a one-time event? You must include one or two examples from the cladogram to justify your answer. In addition, submit the answers to the ten graded questions online. You will find these questions as a separate item with the exercises in the software package. The first time you run the SimUText application, make sure to set the country of your school to Canada using the Change Location link in the upper left. ER Ee CI A A Where is your school located? | United States v United States Canada lerver (not needed unless direct§ Other Country I Canada Q Change Location Close

exercise-3simulation-jnhjfbbz.docx changelocation-jvldkilg-na3k3ems.png

Dr Shweta · Accepted Answer

Exercise 1: Wolves and the Valley
Reference sequence: Sequence of 100 nucleotides of FIRST WOLF of Pack A:
ATTATATAAAGTTTACTGCCAGGTTAATCCGAACGGAATCCGCAGACGGCCAAAAGACGACCCATAGGCAGTTG
ATTTGCCCAGTCTGCGGAGTTCGATA
Solution of 5.1: 
Yes, the nucleotide sequence of two wolfs are different at two positions: position 30 where first one has G and second has A and at position 79 where first one has C and second one has T.
Solution of 6.1: 
Yes, the nucleotide sequence of first wolfs of pack B is different from wolf of pack A at 15 positions 
Solution of 7.1 and 7.2
7.1: Yes, the nucleotide sequence of second wolfs of pack B is different from wolf of pack A at 15 positions.
7.2: But there is no difference in the nucleotide sequence of first and second wolfs of pack B
8.1 Difference in physical appearance:
The colour and size of the 4 wolves are different: white 118, yellow:110, black: 58, brown: 70
Exercise 2: Evolution by Genetic Drift
4.1 There are 2 differences found between the wolves 200 generations apart
5,1 Difference after 400 generations: 12
Difference after 600 generations: 13
Difference after 800 generations: 15
9.1 Mutation invoked: 
Mutation from T to A
Index position: 16
Generation: 147
12.1 The mutation disappears after 3 generations
13.1 When this process repeated 3-4 times, every time the mutation disappears after 2-3 generations.
13.2 Random mutations become more likely to be disappear.
14.1 When inferring evolutionary relationships between dogs, it is preferable to choose a neutral sequence since it offers a more precise depiction of evolution, in contrast to sequences impacted by selection that may be modified by selective influences.
Exercise 3: Population divergence: 
1.1 plot of genetic distance vs, time
1.2 The linear shape of the plot shows that genetic differences increases over time.
8.1 shape of plot: linear
8.2 As per this shape, genetic distance increases over time
8.3 Yes, it matches with my prediction of question 1.1 and 1.2.
8.4 There are 27 differences between the sequences sampled from two populations, and from the plot it is believed that these populations have been diverging from 500 generations
Exercise 4: Reconstruct a tree
3.1 Arch to black forest at generation 97
5.1 Arch to cloud forest at generation 404
6.1 Arch to deep forest at generation 719
8.1 Differences between Arch and Black: _____29___
Differences between Arch and Cloud: __34______
Differences between Arch and Deep: ____16____
9.1 Differences between Black and Cloud: _28_______
Differences between Black and Deep: _25_______
10.1 Differences between Cloud and Deep: ____36____
11.1 Arch and deep forest populations are most closely related,

I need help with a simulation exercises and question on evolution. In the dog domestication exercises, you will compare DNA sequences of wolves and construct phylogenetic trees. Then you will simulate...

Answer To: I need help with a simulation exercises and question on evolution. In the dog domestication...

Answer To This Question Is Available To Download

Related Questions & Answers

Submit New Assignment

Sun	Mon	Tue	Wed	Thu	Fri	Sat
30	31	1	2	3	4	5
6	7	8	9	10	11	12
13	14	15	16	17	18	19
20	21	22	23	24	25	26
27	28	29	30	1	2	3