5 Human Genetics L a b o r a t o r y Name: Name: Section: TA: BISC 103 HAND-IN EXERCISE 1 (20 PTS.) 1. Draw your child’s face here. Take a picture of your drawing and upload it to blackboard. Gender:...

I have biology labs that I have no clue how to do and need them finished. you don't necessarily need to do the lab to complete the assignment but that just depends on how knowledgable the person is


5 Human Genetics L a b o r a t o r y Name: Name: Section: TA: BISC 103 HAND-IN EXERCISE 1 (20 PTS.) 1. Draw your child’s face here. Take a picture of your drawing and upload it to blackboard. Gender: ________ (10 pts) laBoraTory 5 • 67 Determine your personal phenotype and genotype on the table below. Type the alleles for your genotype for each trait in columns labeled Allele 1 and Allele 2. E.g., If you are a male, write X in Allele 1, and Y in Allele 2. If your face is Oval, write O in Allele 1, and O in Allele 2. Do this for all of the traits listed. Table 1. Your phenotype, genotype, and alleles. TRAIT (ALLELE) DOMINANT HETEROZYGOUS RECESSIVE ALLELE 1 ALLELE 2 Sex Female XX Male XY Face shape (O) Oval OO Other oo Chin size (C) Average CC Large Cc Small cc Ear size (A) Average AA Large Aa Small aa Ear length (L) Long LL Short ll Earlobes (K) Attached KK Free kk Nose size (N) Average NN Large Nn Small nn Eye size (T) Large TT Small tt Eye shape (U) Round UU Other uu Eye color (E) Brownish EE Greenish Ee Blue ee Eyebrow (B) Separate BB Unibrow bb Eyelashes (S) Long SS Short ss Freckles (F) Present FF Absent ff Lip shape (P) Full PP Thin pp Hair curl ( R) Curly RR Wavy Rr Straight rr Hair color (Z) Black ZZ Brown/red Zz Blond zz Hair texture (Q) Average QQ Thick Qq Thin qq laBoraTory 5 • 69 From this table, select either Allele 1 or Allele 2. If you are a male, then you need a female partner so make sure you put X in the box for Allele 1 and 2. If you are a female, then you need a male partner so put X in the box for allele 1 and Y in the box for allele 2. Then select either the column for allele 1 or 2 (only need 1 column) and record the letter (allele) in the appropriate box for the trait and sex (Male or Female) on page 71. Data Table: Male or Female phenotype, genotype, and alleles. TRAIT (ALLELE) DOMINANT HETEROZYGOUS RECESSIVE ALLELE 1 ALLELE 2 Sex Female XX Male XY Face shape (O) Oval OO Other oo Chin size (C) Average CC Large Cc Small cc Ear size (A) Average AA Large Aa Small aa Ear length (L) Long LL Short ll Earlobes (K) Attached KK Free kk Nose size (N) Average NN Large Nn Small nn Eye size (T) Large TT Small tt Eye shape (U) Round UU Other uu Eye color (E) Brownish EE Greenish Ee Blue ee Eyebrow (B) Separate BB Unibrow bb Eyelashes (S) Long SS Short ss Freckles (F) Present FF Absent ff Lip shape (P) Full PP Thin pp Hair curl ( R) Curly RR Wavy Rr Straight rr Hair color (Z) Black ZZ Brown/red Zz Blond zz Hair texture (Q) Average QQ Thick Qq Thin qq laBoraTory 5 • 69 o o C c A A L L k k N n T T U U e e B B S S f f P P R r Z Z Q q Select either Allele 1 or Allele 2 from Table 1 - Your genotype . Record the allele for each trait under the column Sperm (Male) if your are male or Egg (Female) if you are a female. In the other column (your partner - male or female) used the Data Table to fill in the alleles for each trait. Write in the phenotype for each trait using Table 1 to determine the phenotype. (10 pts) Table 2. Your child’s genotype and phenotype. TRAIT (ALLELE) GENOTYPE PHENOTYPE SPERM (MALE) EGG (FEMALE) Sex Face shape (O) Chin size (C) Ear size (A) Ear length (L) Earlobes (K) Nose size (N) Eye size (T) Eye shape (U) Eye color (E) Eyebrow (B) Eyelashes (S) Freckles (F) Lip shape (P) Hair curl ( R) Hair color (Z) Hair texture (Q) laBoraTory 5 • 71 5 Molecular Genetics Simulation L a b o r a t o r y Name: Section: TA: BISC 103 HAND-IN EXERCISE 1 (25 PTS.) 1. Use the highlight pen feature, highlight the CAT repeats in each of the DNA sequences below. Record the number of CAT repeats for each DNA strand. (15 pts) Standards: 5’AGCTTCATTTA3’ 5’AGCTTCATCATCATCATCATCATCATTTA3’ 5’AGCTTCATCATTTA3’ 5’AGCTTCATCATCATCATCATCATTTA3’ 5’AGCTTCATCATCATTTA3’ 5’AGCTTCATCATCATCATCATTTA3’ 5’AGCTTCATCATCATCATTTA3’ Mother: 5’AAGCTTCATCATTTAAGCTTCAAAGCTTTCGAC3’ 5’AAGCTTCATCATCATCATCATTTAAGCTTCAAA3’ Child: 5’AAGCTTCATCATCATCATCATCATTTAAGCTTC3’ 5’AAGCTTCATCATCATCATCATTTAAGCTTCAAA3’ Husband: 5’AAGCTTCATCATCATTTAAGCTTCAAAGCTTTC3’ 5’AAGCTTCATCATCATCATCATCATCATTTAAGC3’ Lover: 5’AAGCTTCATCATCATCATCATCATTTAAGCTTC3’ 5’AAGCTTCATCATCATCATTTAAGCTTCAAAGCT3’ laBoraTory 5 • 79 2. Draw the bands on the gel below. Label the lanes. (9 pts) 3. Which man is the father? (1 pt) 80 • MoleCular geneTICs sIMulaTIon—hoW Many “CaTs”? Lab 5 Data Table.pdf BISC 103 Lab 5 Pts 1 & 2.pdf Name: Section: TA: Gender: Text1: Text2: Text3: Text4: Text21: Text22: Text23: Text24: Text25: Text26: Text27: Text28: Text29: Text30: Text31: Text32: Text33: Text34: Text35: Text36: Text37: Text38: Text39: Text40: Text41: Text42: Text43: Text44: Text45: Text46: Text47: Text48: Text49: Text50: Sex_2: Text51: Text52: Text53: Text54: Text55: Text56: Text57: Text58: Text59: Text60: Text61: Text62: Text63: Text64: Text65: Text66: Text67: Text68: Text69: Text70: Text71: Text72: Text73: Text74: Text75: Text76: Text77: Text78: Text79: Text80: Text81: Text82: Text83: Text84: Text85: Text86: Text87: Text88: Text89: Text90: Text91: Text92: Text93: Text94: Text95: Text96: Text97: Text98: Text99: Text100: Name_3: Section_2: TA_2: Text117: Text121: Text118: Text119: Text122: Text123: Text120: Text124: Text125: Text126: Text127: Text128: Text129: Text130: Text131: undefined: undefined_2: undefined_3: undefined_4: undefined_5: undefined_6: Which man is the father: