Bioinformatics Assignment Below are two definitions of Bioinformatics: “Bioinformatics is conceptualizing biology in terms of macromolecules and then applying "informatics" techniques (derived from...

Can it be done?


Bioinformatics Assignment Below are two definitions of Bioinformatics: “Bioinformatics is conceptualizing biology in terms of macromolecules and then applying "informatics" techniques (derived from disciplines such as applied math, computer science, and statistics) to understand and organize the information associated with these molecules, on a large-scale” Methods Inf Med. 2001;40(4):346-58. “Bioinformatics is an interdisciplinary field that develops methods and software tools for understanding biological data. As an interdisciplinary field of science, bioinformatics combines computer science, statistics, mathematics, and engineering to analyze and interpret biological data” Wikipedia Also: Click the YouTube links below to view short videos on Bioinformatics, NCBI and BLAST. NCBI is a gene database and BLAST is a biocomputational tool. What is Bioinformatics? What is NCBI How to Use BLAST for Finding and Aligning DNA or Protein Sequences Your task: You are a computational biologist working in a research lab at the Rockville campus of Montgomery College. In the process of sequencing the genome of an organism, you have found the following nucleotide sequence (below). Your research advisor suspects that the DNA sequence in question is part of an ORF or Open Reading Frame. (What is an ORF?) TTTTCGATCTCGGCGGCGGTACCTTCGATGTGTCCATTTTGACGATCGAAGATGGTATCTTCGAAGTAAA GTCCACCGCCGGAGACACGCACTTGGGAGGAGAGGACTTCGACAACCGTATGGTCAACCACTTTGTCCAA GAATTCAAGAGGAAATACAAGAAGGACCTCGCCACCAACAAGAGGGCCCTGCGACGACTTCGCACTGCCT GTGAAAGGGCGAAGAGAACTCTCTCCTCGTCCACCCAGGCCAGTATTGAAATTGATTCTCTCTTCGAGGG TATTGATTTCTACACCTCCATCACCAGGGCTCGTTTTGAGGAGCTGAACGCTGACTTGTTCAGATCTACA ATGGAGCCTGTAGAGAAGTCCCTGCGTGACGCTAAAATGGACAAGTCCCAAATTCACGACATCGTACTCG You decide to find out whether this DNA sequence is part of a gene. You do a BLASTN search or nucleotide BLAST against the genomic database maintained by the National Center for Biotechnology information (NCBI). To do this: · Go to the Nucleotide BLAST page · Copy and paste the DNA sequence in the “Enter Query Sequence” field and click the “BLAST” button at the bottom of the page · What is the gene to which this ORF come from? · You should see a table in the middle of the report page entitled “Sequences producing significant alignments” · Click on the fifth link in the table (it should have the following accession number: MN747123.1 · Click on the accession number link (MN747123.1) · This will take you to the gene’s NCBI record. At this point, you should know the gene and protein’s identity and well s the organism from which the gene was isolated. · On the new page you will see a box entitled “Related information” on the right side · Click on “protein” · This will lead you to a new page with a translation of the gene. · Click on “FASTA” at the top of the page. This will give you the protein’s amino acid sequence (Using the One-letter format for each amino acid) You then decide to determine the protein’s three-dimensional structure through homology modeling. What is homology modeling? “Homology modeling, also known as comparative modeling of protein, refers to constructing an atomic-resolution model of the "target" protein from its amino acid sequence and an experimental three-dimensional structure of a related homologous protein (the "template"). Homology modeling relies on the identification of one or more known protein structures likely to resemble the structure of the query sequence, and on the production of an alignment that maps residues in the query sequence to residues in the template sequence.” Wikipedia Homology modeling of the protein Open a new browser window: https://swissmodel.expasy.org/interactive Copy the protein’s amino acid sequence from the NCBI page (The protein sequence will use the one-letter format for the amino acids eg. MVAF……). Paste the protein’s primary structure into the Swiss-Model workspace. Enter your email address and a project title and click on “Build Model”. You may also wait for the server to generate the model(s). This should take less than 15 minutes, but you may experience a longer wait time if the server is very busy. At this point the software is going to work to attempt to generate a model (or several models) for your protein. This may take a while depending on network traffic. Instead of waiting for the results, you can close your browser. When your model is ready, you will receive an email message with a link to your results page. If SWISS-MODEL generates several models, sort them by GMQE (Global Model Quality Estimation). GMQE is a number between 0 and 1; a higher GMQE indicates a higher degree of model reliability. Click on the model’s picture with the highest GMQE value, and it will be displayed in the model viewer window. At this point, select the schematic representations of your protein’s 3D structure (ribbon diagram, ball and stick, space filling etc.) and take a high-resolution image of your model. The image will be downloaded into your computer as a png file. (See image below) Report: Answer the questions on the report page (below): Your assignment must be submitted to the proper assignment in Blackboard. Only submit the report page(s) You will be penalized by 3 points if you submit pages from the other parts of this assignment The assignment is worth 15 points The assignment is due on or before 7/06/2022. Late assignments will not be accepted. You will not receive credit for this assignment if I find evidence of plagiarism Bioinformatics assignment Summer 2022 Report Page BIOL101 Dr. Aubrey A Smith Bioinformatics assignment 1. What is Bioinformatics (in your own words) 2.What is an ORF? 3.What does BLAST stand for? 4.What does BLAST allow scientists to do? (In your own words) 5. What is an accession number? 6.What is the name of the protein encoded by the gene from which the partial DNA sequence is derived? 7.What organism (specific name) does the gene or protein come from? 8.Is the organism a prokaryote or a eukaryote? 9.What is SWISS-MODEL? (In your own words) 10.What is homology modeling (in your own words)? 12.What are the monomers of the protein? 13.Attach or paste a copy of the modeled 3D structure of the protein