A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide....

Extracted text: A. Consider the following DNA sequence (coding strand) located near the middle of the coding region of a gene in lampreys. The numbers atop the nucleotides represent the position # of a nucleotide. The underlined nucleotides denote a codon in frame. The figure also identifies the sequence of a complete intron. DNA 50 55 60 65 70 75 80 85 5' - CCTGAGTCCGAGGGTGAACGAG TAGTAGTAGTAGTAGTAGTAG- 3' Intron A. Which of the following is almost certain to result in a shorter than normal DNA? You may choose than In event, explain choice(s). more one answer. any your I. T→A mutation at nucleotide #59 II. G→T mutation at nucleotide #60 III. 3 nucleotide deletion in the middle of the intron IV. C>A mutation at nucleotide #54 B. In your opinion, could the intron sequence serve as a molecular marker? In your own words, explain your reasoning. C. Suppose the base at position 70 changes to A (adenine), would this be considered a mutation? In your own words, explain your reasoning.