6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddTTP were also added. Write out the sequence of 4 DNA...

6.You have used the primer 5' CTGA 3' in a DNA<br>sequencing reaction with the template DNA sequence<br>shown below. DNTPS, DNA polymerase and ddTTP were<br>also added. Write out the sequence of 4 DNA<br>fragments you expect to produce in your sequencing<br>reaction. Include the 5' and 3' ends of each fragment<br>in your answer.<br>3' AAGACTCGATCGATCGTTTCCTCA 5'<br>

Extracted text: 6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddTTP were also added. Write out the sequence of 4 DNA fragments you expect to produce in your sequencing reaction. Include the 5' and 3' ends of each fragment in your answer. 3' AAGACTCGATCGATCGTTTCCTCA 5'

Jun 11, 2022

SOLUTION.PDF

6.You have used the primer 5' CTGA 3' in a DNA sequencing reaction with the template DNA sequence shown below. DNTPS, DNA polymerase and ddTTP were also added. Write out the sequence of 4 DNA...

Get Answer To This Question

Related Questions & Answers

Submit New Assignment