1.Refer to question 3 in More Genetic TIPS before answering this question. Based on the multiple-sequence alignment in Figure 24.10, what is/are the most probable time(s) that mutations occurred in...

1.Refer to question 3 in More Genetic TIPS before answering this question. Based on the multiple-sequence alignment in Figure 24.10, what is/are the most probable time(s) that mutations occurred in the human globin gene family to produce the following amino acid differences?

A. His-119 and Arg-119

B. Gly-121 and Pro-121

C. Glu-103, Val-103, and Ala-103

2. Below is a short nucleotide sequence from a gene. Use the Internet (e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what gene this sequence is from. Also, determine the species in which this gene sequence is found.

5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC

GCCACTGATCATTA–3’